Optional: Reintegration vectors can be introduced via the attP site via another round of injection. Cre recombinase lines such as BL#766 and BL#851 from the Bloomington stock centre can be used. This can improve expression of the integrated fragment. Optional: The pax-GFP flanked by loxP sites can be excised through Cre expression ( Figure 4B). For PCR reaction mixture and PCR conditions, refer to Before you begin steps 5d-e. Design two sets of primers for the PCR verification, such that one of each set binds just outside the regions that correspond to the 5′ and 3′ arms, and the other binds to the GFP coding sequence (primers 1–4 in Figure 4B). PTV GFP 3′arm reverse primer for verification: CCATGATTACGCCAAGCĮxtract gDNA from transformant lines and PCR verify the insertion is in the correct location. PTV GFP 3′arm forward primer for verification: GTTGTGGTTTGTCCAAACTCAT PTV GFP Pax reverse primer for verification: GAATTAGCTCTAATTGAATTAGTCTCTAATTGAATT PTV GFP 5′arm forward primer for verification: CAGTCACGACGTTGTAAAACGA PCFD4 verification : GACACAGCGCGTACGTCCTTCG Invitrogen PureLink HiPure Plasmid Maxiprep Kitĭrosophila melanogaster : yw nos-Cas9(III-attP2) The safest strategy is to include no more than the first 5–10bp of the target site in your homology arm.Ĭhemicals, peptides, and recombinant proteins Alternatively, a few bases in the 10 nucleotides proceeding the PAM and the PAM itself can be changed in the target site sequence in the repair plasmid (as in the example of DWnt4). The homology arms may contain part of the target site but MUST NOT include the PAM sequence (nGG). Crucially, in order to prevent Cas9 from cleaving the repair plasmid before it has a chance to integrate, the homology arms MUST NOT contain the full target site. The boundaries of the 5′ and 3′ homology arms should be no more than 50bp away from the double strand break, ideally less than 10bp away if possible. The pax-GFP marker allows selection based on GFP signal in the larval CNS, as well as the adult eye and ocelli ( Horn et al., 2000). The parent repair plasmid, pTV GFP was derived from TV ΔattP -Pax-Cherry, where the pax-Cherry marker is replaced with pax-GFP ( Poernbacher et al., 2019, Yu et al., 2020).
0 Comments
Leave a Reply. |